Product Name
HMBS, Blocking Peptide
Full Product Name
HMBS Peptide
Product Gene Name
HMBS blocking peptide
[Similar Products]
Product Synonym Gene Name
PBG-D; PBGD; UPS; PORC[Similar Products]
HMBS peptide (MBS3236623) is used for blocking the activity of HMBS antibody (MBS3211675)
Research Use Only
For Research Use Only. Not for use in diagnostic procedures.
3D Structure
ModBase 3D Structure for P08397
Form/Format
Lyophilized powder
Preparation and Storage
Add 100ul of sterile PBS. Final peptide concentration is 1 mg/ml in PBS. For longer periods of storage, store at -20 degree C. Avoid repeat freeze-thaw cycles.
Other Notes
Small volumes of HMBS blocking peptide vial(s) may occasionally become entrapped in the seal of the product vial during shipment and storage. If necessary, briefly centrifuge the vial on a tabletop centrifuge to dislodge any liquid in the container`s cap. Certain products may require to ship with dry ice and additional dry ice fee may apply.
Related Product Information for
HMBS blocking peptide
This is a synthetic peptide designed for use in combination with anti-HMBS antibody made
Target Description: HMBS is a member of the hydroxymethylbilane synthase superfamily. It is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria.This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.
Product Categories/Family for HMBS blocking peptide
Peptide
Applications Tested/Suitable for HMBS blocking peptide
Western Blot (WB)
NCBI/Uniprot data below describe general gene information for HMBS. It may not necessarily be applicable to this product.
NCBI Accession #
NP_001019553
[Other Products]
NCBI GenBank Nucleotide #
NM_001024382
[Other Products]
UniProt Primary Accession #
P08397
[Other Products]
UniProt Related Accession #
P08397[Other Products]
NCBI Official Full Name
Porphobilinogen deaminase
NCBI Official Synonym Full Names
hydroxymethylbilane synthase
NCBI Official Symbol
HMBS [Similar Products]
NCBI Official Synonym Symbols
UPS; PBGD; PORC; PBG-D
[Similar Products]
NCBI Protein Information
porphobilinogen deaminase
UniProt Protein Name
Porphobilinogen deaminase
UniProt Synonym Protein Names
Hydroxymethylbilane synthase; HMBS; Pre-uroporphyrinogen synthase
UniProt Gene Name
HMBS [Similar Products]
UniProt Synonym Gene Names
PBGD; UPS; PBG-D; HMBS [Similar Products]
UniProt Entry Name
HEM3_HUMAN
NCBI Summary for HMBS
This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
UniProt Comments for HMBS
HMBS: Tetrapolymerization of the monopyrrole PBG into the hydroxymethylbilane pre-uroporphyrinogen in several discrete steps. Defects in HMBS are the cause of acute intermittent porphyria (AIP). AIP is a form of porphyria. Porphyrias are inherited defects in the biosynthesis of heme, resulting in the accumulation and increased excretion of porphyrins or porphyrin precursors. They are classified as erythropoietic or hepatic, depending on whether the enzyme deficiency occurs in red blood cells or in the liver. AIP is an autosomal dominant form of hepatic porphyria characterized by acute attacks of neurological dysfunctions with abdominal pain, hypertension, tachycardia, and peripheral neuropathy. Most attacks are precipitated by drugs, alcohol, caloric deprivation, infections, or endocrine factors. Belongs to the HMBS family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 2.5.1.61; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; Transferase; Mitochondrial
Chromosomal Location of Human Ortholog: 11q23.3
Cellular Component: cytosol
Molecular Function: hydroxymethylbilane synthase activity
Biological Process: porphyrin metabolic process; protoporphyrinogen IX biosynthetic process; peptidyl-pyrromethane cofactor linkage; heme biosynthetic process
Disease: Porphyria, Acute Intermittent
Research Articles on HMBS
1. In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation.
Precautions
All of MyBioSource's Products are for scientific laboratory research purposes and are not for diagnostic, therapeutics, prophylactic or in vivo use. Through your purchase, you expressly represent and warrant to MyBioSource that you will properly test and use any Products purchased from MyBioSource in accordance with industry standards. MyBioSource and its authorized distributors reserve the right to refuse to process any order where we reasonably believe that the intended use will fall outside of our acceptable guidelines.
Disclaimer
While every efforts were made to ensure the accuracy of the information provided in this datasheet, MyBioSource will not be liable for any omissions or errors contained herein. MyBioSource reserves the right to make changes to this datasheet at any time without prior notice.
It is the responsibility of the customer to report product performance issues to MyBioSource within 30 days of receipt of the product. Please visit our Terms & Conditions page for more information.