Product Name
Porphobilinogen Deaminase/HMBS/PBGD, Recombinant Protein
Full Product Name
Recombinant Human Porphobilinogen Deaminase/HMBS/PBGD Protein (C-6His)
Product Synonym Names
Porphobilinogen Deaminase; PBG-D; Hydroxymethylbilane Synthase; HMBS; Pre-Uroporphyrinogen Synthase; HMBS; PBGD; UPS
Product Gene Name
HMBS/PBGD recombinant protein
[Similar Products]
Research Use Only
For Research Use Only. Not for use in diagnostic procedures.
Sequence Positions
Ser2-His361
3D Structure
ModBase 3D Structure for P08397
Purity/Purification
>95% as determined by reducing SDS-PAGE.
Form/Format
Lyophilized from a 0.2 mum filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Endotoxin
<1.0 EU per ug as determined by LAL test.
Preparation and Storage
Lyophilized protein should be stored at < -20 degree C, though stable at room temperature for 3 weeks.
Reconstituted protein solution can be stored at 4-7 degree C for 2-7 days. Aliquots of reconstituted samples are stable at < -20 degree C for 3 months.
ISO Certification
Manufactured in an ISO 9001:2015 Certified Laboratory.
Other Notes
Small volumes of HMBS/PBGD recombinant protein vial(s) may occasionally become entrapped in the seal of the product vial during shipment and storage. If necessary, briefly centrifuge the vial on a tabletop centrifuge to dislodge any liquid in the container`s cap. Certain products may require to ship with dry ice and additional dry ice fee may apply.
Related Product Information for
HMBS/PBGD recombinant protein
Porphobilinogen Deaminase (HMBS) is a member of the HMBS family. PBGD is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. HMBS is involved in the production of heme, which is important for all of the body's organs, although it is most abundant in the blood, bone marrow, and liver. In addition, Heme is an essential component of iron-containing proteins called hemoproteins, including hemoglobin. Defects in PBGD are the cause of acute intermittent porphyria.
NCBI/Uniprot data below describe general gene information for HMBS/PBGD. It may not necessarily be applicable to this product.
NCBI Accession #
NP_000181.2
[Other Products]
NCBI GenBank Nucleotide #
NM_000190.4
[Other Products]
UniProt Primary Accession #
P08397
[Other Products]
UniProt Secondary Accession #
P08396; Q16012; A8K2L0; G3V1P4; G5EA58[Other Products]
UniProt Related Accession #
P08397[Other Products]
Molecular Weight
Molecular Mass: 40.5 kDa
Actual Protein Molecular Mass: 47 kDa
NCBI Official Full Name
porphobilinogen deaminase isoform 1
NCBI Official Synonym Full Names
hydroxymethylbilane synthase
NCBI Official Symbol
HMBS [Similar Products]
NCBI Official Synonym Symbols
UPS; PBGD; PORC; PBG-D
[Similar Products]
NCBI Protein Information
porphobilinogen deaminase
UniProt Protein Name
Porphobilinogen deaminase
UniProt Synonym Protein Names
Hydroxymethylbilane synthase; HMBS; Pre-uroporphyrinogen synthase
UniProt Gene Name
HMBS [Similar Products]
UniProt Synonym Gene Names
PBGD; UPS; PBG-D; HMBS [Similar Products]
NCBI Summary for HMBS/PBGD
This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
UniProt Comments for HMBS/PBGD
Tetrapolymerization of the monopyrrole PBG into the hydroxymethylbilane pre-uroporphyrinogen in several discrete steps.
Research Articles on HMBS/PBGD
1. In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation.
Precautions
All of MyBioSource's Products are for scientific laboratory research purposes and are not for diagnostic, therapeutics, prophylactic or in vivo use. Through your purchase, you expressly represent and warrant to MyBioSource that you will properly test and use any Products purchased from MyBioSource in accordance with industry standards. MyBioSource and its authorized distributors reserve the right to refuse to process any order where we reasonably believe that the intended use will fall outside of our acceptable guidelines.
Disclaimer
While every efforts were made to ensure the accuracy of the information provided in this datasheet, MyBioSource will not be liable for any omissions or errors contained herein. MyBioSource reserves the right to make changes to this datasheet at any time without prior notice.
It is the responsibility of the customer to report product performance issues to MyBioSource within 30 days of receipt of the product. Please visit our Terms & Conditions page for more information.